Конвертирование tab faa

Простейший конвертер на Perl.

Часто при работе возникает следующая задача: последовательности хранятся в tab-delimited файле, при этом может быть несколько колонок с дополнительной информацией. Вместо этого последовательности нужно сохранить в обычный формат FASTA, например, чтобы передать в программу выравнивания. Иногда требуется сделать обратное преобразование.

 

Ниже приведен простейший Perl-скрипт, который преобразует tab-delimited файл в FASTA и обратно. При конвертировании tab->faa нужно указать индексы колонок (начинаются c 1), при конвертировании faa->tab ничего указывать не нужно.

#convert FASTA to TAB files and vice versa
use Getopt::Long;  
use Bio::SeqIO;

sub help {
  print " convert FASTA to TAB files and vice versa\n";
  print " Usage:\n";
  print "  -f  FASTA file name\n";
  print "  -a  fasta -> tab mode\n";
  print "  -t  tab -> fasta mode\n";
  print "  -ic index of ID column (1-based)\n";
  print "  -sc index of sequence column (1-based)\n";
}
 

#--------------------- main part --------------------------------
# GLOBAL VARIABLES
  $FNAME=undef;  # file to convert
  $FAA2TAB=undef;
  $TAB2FAA=undef;
  $ID_COL=undef;  # 1-based index of identifier in table
  $SEQ_COL=undef; # index of column with sequence
  
  GetOptions ('f=s'  => \$FNAME,
              'a'    => \$FAA2TAB,
              'ic=i' => \$ID_COL,
              'sc=i' => \$SEQ_COL,
              't'    => \$TAB2FAA,  
             'help|?|h' => \$help );
  if($help) { help(); exit;}
 
  if(!($FNAME)) { die "please specify -f FNAME"; }
  if((!($FAA2TAB))&&(!($TAB2FAA)))  { die "please specify regime: tab2faa(-t) or faa2tab(-a)"; }
 
  $ID_COL=$ID_COL-1;
  $SEQ_COL=$SEQ_COL-1;
  
  if ($TAB2FAA) {
    if($ID_COL<0)  { die "please specify -ic ID_COL   (1-based)"; }
    if($SEQ_COL<0) { die "please specify -sc SEQ_COL  (1-based)"; }
   
    open (INFILE, $FNAME) or print("Error opening file");
    while () {
      $str=$_; chomp($str);
      my @line=split(/\t/,$str);
      print '>'.$line[$ID_COL]."\n";
      print $line[$SEQ_COL]."\n";
    }
    close(INFILE);
  }
 
  if ($FAA2TAB) {
    my $FastaFile = Bio::SeqIO->new( -file => $FNAME, -format => 'fasta');
    while (my $faaseq = $FastaFile->next_seq) {
      my $seq=uc($faaseq->seq);  #uppercase
      print $faaseq->primary_seq->display_id."\t".$seq."\n";
     
    }
  }

Комментарии   

 
0 #1 Guest 31.01.2012 20:36
Gymnopetalum orientale TCCTTCGCTCCTGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGTAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTAATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATACTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAGTAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATTGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Gymnopetalum scabrum TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGAAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGGTCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGGGGATCCTCAAAAAAAAA
Gymnopetalum scabrum TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGGGGATCCTCAAAAAAAAA
Gymnopetalum tubiflorum ATTCTTTTTTCACGAGTATTCTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCCTGCATTATGTTAGATATCAAGGAAAAGCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAC
Gymnopetalum tubiflorum AAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCCTGCATTATGTTAGATATCAAGGAAAAGCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCG
Gymnopetalum tubiflorum TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGATTCTTTTTTCACGAGTATTCTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCCTGCATTATGTTAGATATCAAGGAAAAGCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAC
Hodgsonia heteroclita TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATATCATTTTTATGTATGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAATTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTCTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Lagenaria siceraria TCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTTGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATACAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCTTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAAGATACGCCACTTCTGATTAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCGCTTGACTTTTTGGGCTATATTTCAAGTGTGCGATTAAATCCTTCAGTGGTATGGAGTCAGATGTTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Luffa aegyptiaca TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATATTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGGGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGTCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAA
Luffa echinata TCTTCGCTCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTACGGAAAAATCGAACATCTTGTCAAAAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACACCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCGGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATGGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes auriculata CTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAATGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATTGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes beccariana TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes celebica CTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTGTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACATTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTCTTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes cucumerina TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGATTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATCTATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGTTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTTACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAC
Trichosanthes dioica CTTTTCATTTATTACGATTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGACTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAC
Trichosanthes edulis CAAATCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGTTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes globosa TCCTTCGCTCATGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTGTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACATTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGCATCGATTCGTCGGATATTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTATAGAGGATCCTCAAAAAAAAA
Trichosanthes holtzei TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCATGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCCAAGTGTTTGCTAATTATTTTTCGGATATCTTACGGGTCTTCGAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCGGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes homophylla TCCTTCGCTCCCGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCATATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGACATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes hylonoma TCCTTCGCTCCCGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTACTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTAAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes inthanonensis TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCGTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes inthanonensis TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTGTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes kinabaluensis TCTTCGCTCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTGTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACATTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes kirilowii subsp. japonica TCCTTCGCTCCCGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACAGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes kirilowii subsp. japonica CTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACAGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATATATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes laceribractea TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGTCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes laceribractea CTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGTCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes lepiniana TCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes lepiniana TTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCAAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTGATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATAGAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes miyagii TTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGTAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes montana subsp. montana TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGTGTTCTCTTGACTTTGTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACATTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes mucronata ATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCA
Trichosanthes multiloba TCCTTCGCTCCCGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACATGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCAAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes multiloba CCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACATGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCAAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes nervifolia TTCTTTTCATTTATTACGATTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCGGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCAAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAC
Trichosanthes odontosperma TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATGATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTTTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes odontosperma TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes odontosperma TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pallida TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGAGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pallida CTCTTCTTTTCTTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGAGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes papuana TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTATTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAACGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAA
Trichosanthes pedata CTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pendula TCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAAAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATATATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCCTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pentaphylla TCTTCGCTCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTATTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAACGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pentaphylla TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTATTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAACGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes phonsenae TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTCAATCCTT
Trichosanthes phonsenae TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTGTGGGCTATATTTCAAGTGTGCGACTCAATCC
Trichosanthes pilosa TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCATGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCCAAGTGTTTGCTAATTATTTTTCGGATATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAAGAAGTGGAAATATTACCTTGTAAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pilosa TCTTCGCTCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCATGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCCAAGTGTTTGCTAATTATTTTTCGGATATCTTACGGGTCTTCGAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTATTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pilosa var. roseipulpa TCTTCGCTCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCATGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCCAAGTGTTTGCTAATTATTTTTCGGATATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAAGAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes postarii TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTACGGAAAAATCGAACATCTTGTCAAAAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACACCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCGGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATGGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes postarii ATCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTACGGAAAAATCGAACATCTTGTCAAAAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACACCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCAACTAAATCCTTCGGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATGGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pubera subsp. rubriflos var. fissisetala TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTGTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pubera subsp. rubriflos var. fissisetala TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes pubera subsp. rubriflos var. rubriflos TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCGTTCATGCATTATGTTAGATATCAAGGAAAATCTATTGTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes quinquangulata TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes quinquangulata TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes quinquefolia CGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTGCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTTTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTGTGTTA
Trichosanthes rosthornii TCCTTCGCTCCCGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTTTGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCTGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes subvelutina TCTTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGGCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGGCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAACTTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes subvelutina TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGGCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGGCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes subvelutina TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGGCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGGCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAACTTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes tricuspidata subsp .tricuspidata TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAAAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTTATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes truncata TCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAGTTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCGGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCTAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes truncata TCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAGTTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCGGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCTAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes truncata TCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAGTTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCGGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTA
Trichosanthes villosa TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTGATTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAGTTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCTTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACGAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTGGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes villosa TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAA
Trichosanthes villosa TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCTTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGAATATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTCTTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATATCATTTTTATGTATGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTCAATCC
Trichosanthes fissibracteata TCCTTCGCTCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTACGGTTCGTTTTTCACGAGTATTGTAATTGGAATAGTCTTAGTACTTCAAAAAAATTGATTTCTTTTTTTTCAAAAAGAAATCGAAGATTAGTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCCATTTTCCTTTTTCTACGTAACCAATCTTCTCATATACGATTAACTTCTTATAGGGGCCTTTTTGAGCGACTATATTTCTATGGAAAAATCGAACATCTTGTCAAAGTGTTTGCTAATTATTTTTCGGCTATCTTACGGGTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGTTTCAAAAGATACGCCACTTCTGATGAATAAGTGGAAATATTACCTTGTCAATTTATGGCAATGTCATTTTTATGTGTGGTCACAACCAGAAAGGATCTATATAAACCAATTATCCAAGCGTTCTCTTGACTTTTTGGGCTATATTTCAAGTGTGCGACTAAATCCTTCAGTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACCAAGAAACTCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAACGTGTTAGGGCATCCCATTAGTAAGACGACCTGGATCGATTCGTCGGATTTTGATATTATTGATCGATTTGTGCGTATATCCAGAAATCTTTCTCATTATTACAGAGGATCCTCAAAAAAAAA
Trichosanthes wawrae CCTCTTCT TTTCATTTATTACGG TTCGTTTTTCACGAG TATTGTAATTGGAAT AGTCTTAGTACTTCA AAAAAATTGATTTCT TTTTTTTCAAAAAGA AATCGAAGATTAGTC TTGTTCCTATATAAT TCTTATGTATGTGAA TACGAATCCATTTTC CTTTTTCTACGTAAC CAATCTTCTCATATA CGATTAACTTCTTAT AGGGGCCTTTTTGAG CGAATATATTTCTAT GGAAAAATCGAACAT CTTGTCAAAGTATTT GCTAATTATTTTTCG GCTATCTTACGGGTC TTCAAGGATCCTTTC ATGCATTATGTTAGA TATCAAGGAAAATCG ATTCTGGTTTCAAAA GATACGCCACTTCTG ATGAATAAGTGGAAA TATTACCTTGTCAAT TTATGGCAATGTCAT TTTTATGTGTGGTCA CAACCAGAACGGATC TATATAAACCAATTA TCCAAGCGTTCTCTT GACTTTTTGGGCTAT ATTTCAAGTGTGCGA CTAAATCCTTCAGTG GTATGGAGTCAGATG CTAGAAAATTCATTT CTAATAGATAATGCT ACCAAGAAACTCGAT ACACTAGTTCCTATT ATTACTCTGCTTGGA TCATTGGCTAAAGCG AAATTTTGTAACGTG TTAGGGCATCCCATT AGTAAGACGACCTGG ATCGATTCGTCGGAT TTTGATATTATTGAT CGATTTGTGCGTATA TCCAGAAATCTTTCT CATTATTACAGAGGA TCCTCAAAAAAAAA
Цитировать
 

Добавить комментарий


Защитный код
Обновить